Adenovirus DNA: The Viral Genome and Its Expression by R. J. Roberts, G. Akusjarvi, P. Alestrom, R. E. Gelinas, T.

By R. J. Roberts, G. Akusjarvi, P. Alestrom, R. E. Gelinas, T. R. Gingeras (auth.), Walter Doerfler (eds.)

`This booklet will basically be of significant price to these at once keen on adenovirus examine and will discover a wider viewers end result of the use of adenoviruses by means of molecular biologists learning the mechanisms of gene law. It represents least expensive for cash not just since it is widely dependent, yet due to the titanic numbers of references contained inside it.'
The Society for basic Microbiology Quarterly, thirteen (1986)

Show description

Read Online or Download Adenovirus DNA: The Viral Genome and Its Expression PDF

Similar viral books

The Desk Encyclopedia of Microbiology

The table Encyclopedia of Microbiology goals to supply an inexpensive and prepared entry to a wide number of microbiological themes inside one set of covers. this convenient desk-top reference brings jointly a good choice of paintings through the head scientists within the box. protecting subject matters starting from the elemental technological know-how of microbiology to the present "hot" subject matters within the box.

Encyclopedia of infectious diseases

This can be nearly a distinctive booklet (encyclopedia of infectious illnesses geared toward the proverbial 'intelligent layman'), and is strangely demanding to discover at the retail industry. every one ailment access has an advent via sections on signs and diagnostic course, therapies and outlook, and probability elements and preventive measures.

Pulmonary Infection: An Atlas of Investigation and Management

Infections of the lung make up an important share of the paintings of the respiration and infectious illness general practitioner. Drawing at the illustrative assets of the Edinburgh Royal Infirmary, this fantastically offered atlas presents a visible method of the subject. Dr Hill has chosen a number of photo pictures in an effort to permit the consumer to work out examples of either the infrequent and commonplace manifestations of those issues.

HIV and Young People: Risk and Resilience in the Urban Slum

Revisiting the pondering on vulnerability to HIV and chance of an infection, this publication presents larger figuring out by way of contemplating the danger of HIV an infection along notions of private and collective resilience, dignity and humiliation.

Additional info for Adenovirus DNA: The Viral Genome and Its Expression

Sample text

83X ACCEPTOR splice sit. It. 25X ACCEPTOR splice sit. pllc • • It. 19~ Bal • 33500 TAACTGCAGCACAGCACCACAATATTGTTCAAAATCCCACAGTGCAAGGCGCTGTATCCAAAGCTCATGGCGGGGACCACAGAACCCACGTGGCCATCAT ATTGACGTCGTGTCGTGGTGTTATAACAAGTTTTAGGGTGTCACGTTCCGCGACATAGGTTTCGAGTACCGCCCCTGGTGTCTTGGGTGCACCGGTAGTA oc ~ .. ite in E4 . 20~ . 57~ . 66X ACCEPTOR splice site in E4 for E4 11K protein A. ( 13-16 ) in E4 34500 GTGAACGCGCTCCCCTCCGGTGGCGTGGTCAAACTCTACAGCCAAAGAACAGATAATGGCATTTGTAAGATGTTGCACAATGGCTTCCAAAAGGCAAACT CACTTGCGCGAGGGGAGGCCACCGCACCAGTTTGAGATGTCGGTTTCTTGTCTATTACCGTAAACATTCTACAACGTGTT-ACCGAAGGTTTTCCGTTTGA .

Bl~ CCTTTACTCCAATATTGCGCTGTACCTGCCAGACAAGCTAAAATACAACCCCACCAATGTGGAAATATCTGACAACCCCAACACCTACGACTACATGAAC GGAAATGAGGTTATAACGCGACATGGACGGTCTGTTCGATTTTATGTTGGGGTGGTTACACCTTTATAGACTGTTGGGGTTGTGGATGCTGATGTACTTG 20400 CATGGACAAAAGATGAAACTTTTGCAACACGTAATGAAATAGGAGTGGGTAACAACTTTGCCATGGAAATTAACCTAAATGCCAACCTATGGAGAAATTT GTACCTGTTTTCTACTTTGAAAACGTTGTGCATTACTTTATCCTCACCCATTGTTGAAACGGTACCTTTAATTGGATTTACGGTTGGATACCTCTTTAAA 20300 TTGCCAAATTATTGTTTTCCTCTTGGGGGTATTGGGGTAACTGACACCTATCAAGCTATTAAGGCTAATGGCAATGGCTCAGGCGATAATGGAGATACTA AACGGTTTAATAACAAAAGGAGAACCCCCATAACCCCATTGACTGTGGATAGTTCGATAATTCCGATTACCGTTACCGAGTCCGCTATTACCTCTATGAT 20200 CATAGGTGATAGAACCAGATATTTTTCTATGTGGAATCAGGCTGTAGACAGCTATGATCCAGATGTTAGAATCATTGAAAACCATGGAACTGAGGATGAA GTATCCACTATCTTGGTCTATAAAAAGATACACCTTAGTCCGACATCTGTCGATACTAGGTCTACAATCTTAGTAACTTTTGGTACCTTGACTCCTACTT 20100 GCAACATGGGTGTTCTTGCTGGTCAGGCATCGCAGCTAAATGCCGTGGTAGATTTGCAAGACAGAAACACAGAGCTGTCCTATCAACTCTTGCTTGATTC CGTTGTACCCACAAGAACGACCAGTCCGTAGCGTCGATTTACGGCACCATCTAAACGTTCTGTCTTTGTGTCTCGACAGGATAGTTGAGAACGAACTAAG ~ Ul Bal I 22100 TTTCTGACCAACGACTCAAGCAGGTTTACCAGTTTGAGTACGAGTCACTCCTGCGCCGTAGCGCCATTGCTTCTTCCCCCGACCGCTGTATAACGCTGGA AAAGACTGGTTGCTGAGTTCGTCCAAATGGTCAAACTCATGCTCAGTGAGGACGCGGCATCGCGGTAACGAAGAAGGGGGCTGGCGACATATTGCGACCT 22000 ATAGTCAATACGGCCGGTCGCGAGACTGGGGGCGTACACTGGATGGCCTTTGCCTGGAACCCGCGCTCAAAAACATGCTACCTCTTTGAGCCCTTTGGCT TATCAGTTATGCCGGCCAGCGCTCTGACCCCCGCATGTGACCTACCGGAAACGGACCTTGGGCGCGAGTTTTTGTACGATGGAGAAACTCGGGAAACCGA 60.

94~ Hind III • 13700 CAGCGCGAGCAGGCAGAGGCGGCGCTGCGAAAGGAAAGCTTCCGCAGGCCAAGCAGCTTGTCCGATCTAGGCGCTGCGGCCCCGCGGTCAGATGCGAGTA GTCGCGCTCGTCCGTCTCCGCCGCGACGCTTTCCTTTCGAAGGCGTCCGGTTCGTCGAACAGGCTAGATCCGCGACGCCGGGGCGCCAGTCTACGCTCAT 13600 CGGGGGATTTGAGGTGCCCGAGGGTAACGATGGATTCCTCTGGGACGACATAGACGACAGCGTGTTTTCCCCGCAACCGCAGACCCTGCTAGAGTTGCAA GCCCCCTAAACTCCACGGGCTCCCATTGCTACCTAAGGAGACCCTGCTGTATCTGCTGTCGCACAAAAGGGGCGTTGGCGTCTGGGACGATCTCAACGTT 13500 GCCTAATGGACTACTTGCATCGCGCGGCCGCCGTGAACCCCGAGTATTTCACCAATGCCATCTTGAACCCGCACTGGCTACCGCCCCCTGGTTTCTACAC CGGATTACCTGATGAACGTAGCGCGCCGGCGGCACTTGGGGCTCATAAAGTGGTTACGGTAGAACTTGGGCGTGACCGATGGCGGGGGACCAAAGATGTG 10:) ...

Download PDF sample

Rated 4.24 of 5 – based on 35 votes